An Amusing Joke
Some years after the sudden outbreak and then swift disappearance of SARS-CoV-1 in 2003, of which China, especially the Chinese capital Beijing, was most affected, a conspiracy theory began to circulate online.
Questions regarding the true origin and peculiar nature of SARS were speculated:
Have at any time in written memory we ever had a virus apart from SARS so mysterious that emerged without precedent and without a hint, then disappeared without a trace and without consequence?
Have we ever seen in history a virus other than SARS that mainly affected people of certain ethnicity living in a country with a certain social system?
Severe acute respiratory syndrome (SARS) has been pinned down to a Coronavirus which contains an RNA sequence that does not have a direct association with any known human or animal germ cells. Over the years some people in the West were probing the possibility of the common Coronavirus coat protein genes being manipulated in the laboratory for the purpose of creating a SARS viral vector to propagate foreign genes.
But some Chinese went much further, claiming they have uncovered the signature of the SARS virus creators after decoding a seemingly useless Nucleotide sequence in the SARS genes:
GUUACUGAGGAUAAAGGUAAGAAAAUA
Transcribe the Nucleotide sequence into an RNA sequence, they get something like this:
GUU. ACU. GAG. GAU. AAA. GGU. AAG. AAA. AUA
Convert the RNA sequence to the binary numerical system, they get this:
A = 00
G = 01
U = 10
C = 11
Thus they get this:
011010. 001110. 010001. 010010. 000000. 010110. 000001. 000000. 001000
Convert the binary numerical system to the decimal numerical system, they get this:
26. 14. 17. 18. 0. 22. 1. 0. 8. 6. 14
Convert the numbers to English letters with “0” represented by a blank space, they get this:
ZNQR VA HFN
Decode ROT13 message, they get this:
MADE IN USA
Of course, the above is just an amusing joke.
But below is an amazing probe.
An Amazing Probe
In his recent speech at the International Covid Summit III Eu Parliament, Dr David Martin reviewed the history of the Coronavirus discussion.
A Virus Manipulation, Half A Century Ago
The virus did not emerge suddenly in the last three years, he said, the discussion about the coronavirus actually started in Europe in the mid-1900s.
Further, he stated, the pandemic that we alleged to have happened in the last few years also did not happen overnight. Yet not many people know that coronavirus as a model of a pathogen was actually isolated in 1965, identified as one of the first infectious, replicable viral models that could be used to modify a series of other experiences of the human condition.
In 1966, the first coronavirus model was used as a transatlantic biological experiment in human manipulation, and there have already had the first transatlantic coronavirus data-sharing experiment between the United States and the United Kingdom.
In 1967, which was half a century ago, the first human trials on inoculating people with modified coronavirus were taken place.
“Where were we when we actually allowed in violation of biological and chemical weapons treaties? Where were we?” demanded Dr Martin. “As a human civilization, when we thought it was an acceptable thing to do to take a pathogen for the United States and infect the world with it and what should have been that conversation in 1967?
“That conversation wasn’t had. Ironically the common cold was turned into a chimera in the 1970s.”
A Fizer Covid-Vaccine, 30 Years Ago
“In 1975, 1976 and 1977, we started figuring out how to modify coronavirus by putting it into different animals, pigs and dogs, and not surprisingly by the time we got to 1990, we found out that coronavirus as an infectious agent was an industrial problem for two primary industries, the industries of dogs and pigs. Dog breeders and pigs found coronavirus to create gastrointestinal problems, and that became the basis for Fizers first spike protein vaccine pattern filed in 1990 – 1990 Operation Warp Speed.
“Fizer 1990 the very first spike protein vaccine for coronavirus.
“Isn’t that fascinating that we were told that the spike protein is a new thing we just found out? No, as a matter of fact, we didn’t just find out it was not just now the problem, we found out in 1990 and filed the first patents on vaccines in 1990 for the spike protein of coronavirus.
“Who would have thought Fizer?
“Clearly, the innocent organization that does nothing but promote human health, clearly Fizer, the organization that is not bought to vote in this chamber and very camber of every government around the world, not that Fizer. Certainly, they wouldn’t have had anything to do with this.
“But oh yes they did!”
Fizer’s Covid-Vaccine, It Didn’t Work and They Knew It
“In 1990, they found out that there was a problem with vaccines: they didn’t work. Do you know why they didn’t work? It turns out the coronavirus is a very malleable model, it transforms and it changes and it mutates over time, as a matter of fact, every publication on vaccines for coronavirus from 1990 until 2018, every single publication concluded that coronavirus escapes the vaccine impulse.
“There are thousands of publications to that effect. Not a few hundred and not paid for by pharmaceutical companies. These are publications that are independent scientific research that shows unequivocally including efforts of the chimera modifications made by Ralph Berk in the University of North Carolina Chapel Hill, all of which show vaccines do not work on coronavirus. That’s the science. And that science has never been disputed.”
A Patent on Sars Pathegon, A Year Before the Pademic
“But then we had an interesting development in 2002, and this date is most important because, in 2002, the University of North Carolina Chapel Hill patented Ani, quoted ‘an infectious replication defective clone of coronavirus’.
“Listen to these words: INFECTIOUS REPLICATION DEFECTIVE!
“What does that phrase actually mean? For those of you not familiar with the language, let me unpack it for you. Infectious Replication Defective means a WEAPON. It means something meant to target an individual but not have collateral damage to other individuals.
“And that patent was filed in 2002 on work funded by NIAID Anthony Fauchi from 1999 to 2002 and that work patented at the University of North Carolina Chapel Hill mysteriously preceded Sarts 1.0 by a year!”
A Patent on Sars Pathogen Again, in 2007
“Sars is the research developed by humans weaponizing a life system model to actually attack human beings, and they patented it in 2002. And in 2002 giant surprise, the CDC filed the pattern of coronavirus isolated from humans in violation once again of biological and chemical weapons treaties and laws that we have in the United States.
“When the CDC in April of 2003 filed the patent on Sars Coronavirus isolated from humans, what did they do?
“They downloaded a sequence from China and filed a patent on it in the United States.
“Any of you familiar with biological Chemical weapons treaties knows that’s a violation, that’s a crime. That’s not an innocent oops that’s a CRIME!
“The United States Patent Office went as far as to reject that patent application on two occasions until the CDC decided to bribe the patent office to override the patent examiner to ultimately issue the patent in 2007 on Sars Coronavirus.”
Sars Pathogene, A Bioweapon Platform Technology
The RT-PCR, the test that was allegedly used to identify the risks associated with coronavirus, was identified as a bioterrorism threat in the European Union-sponsored events in 2002 and 2003, observed Dr Martin.
“In 2005, this particular pathogen was specifically labelled as a bioterrorism and bioweapon platform technology. It was actually described as a bio-weapons platform technology in 2005. From 2005 onwards, it was actually a biowarfare-enabling agent. It’s official classification from 2005 forward.
“That is not about public health but a weapon designed to take out humanity!
“NIID has a balance sheet and next to it is a biodefense balance sheet equivalent dollar for dollar matching,” and Dr Martin pointed out the figure is over $10 billion, based on published materials shown on his slides.
However, “no one in the media talks about it.”
6 Years of Lab and Media Preparation, Covid-19 Outbreak
“Our Gain-of-Function moratorium, the moratorium that was supposed to freeze any efforts to do Gain-of-Function research.”
Yet “conveniently in the fall of 2014, the University of North Carolina Chapel Hill received a letter from NIID, saying that the Gain-of-Function moratorium on coronavirus in VIVO should be suspended because their grants had already been funded.”
What does it mean? “It means they received an exemption.” Dr Martin explained.
“A biological weapons lab facility at the University of North Carolina Chapel Hill received an exemption from the Gain-of-Function moratorium so that by 2016, we could publish the journal article that said Sars Coronavirus is poised for human emergence in 2016 at the proceedings of the National Academy of Sciences.
“By the time we get to 2017 and 2018, the following phrase entered into common parlance among the community, there is going to be an accidental or intentional release of a respiratory pathogen.
“Does that sound like a leak? Does that sound like a bat and a pangolin went into a bar in the Wuhan Market and hung out and had sex and woo-hoo behold we got Sars Covid 2?” questioned Dr Martin.
“NO!” he objected firmly. “Accidental or intentional release of a respiratory pathogen was the terminology used FOUR times in April of 2019, seven months before the allegation of patient No. 1. Four patent applications of the medina were modified to include the term ‘accidental or intentional release of a respiratory pathogen’, as the justification for making a vaccine for a thing that did not exist.”
“If you have not done so, please make sure that you make a reference in every investigation into the premeditation nature of this,” Dr Martin urged, “because it was in September of 2019 that the world was informed that we were going to have an accident or intentional release of a respiratory pathogen so that by September 2020 there would be ‘A WORLDWIDE ACCEPTANCE OF A UNIVERSAL VACCINE TEMPLATE’, that’s their words right in front of you on the screen. The intent was to get the world to accept a universal vaccine template and the intent was to use coronavirus to get there.”
Here is a quote from the published material: “Until an infectious disease crisis is very real present, and at the emergency threshold that is often largely ignored, to sustain the funding base beyond the crisis, we need to increase the public understanding of the need for medical countermeasures such as pan influenza or pan coronavirus vaccine. A key driver is the media. And the economics will follow the hype. We need to use that hype to our advantage to get to the real issue investors will respond if they see profit at the end of the process.”
Does the quote “sounds like public health? Sounds like the best of humanity?” Quizzed Dr Martin.
“No! This was premeditated domestic terrorism stated in the proceedings of the National Academy of Sciences in 2015 published in front of them. This is an act of biological and chemical warfare perpetrated on the human race, and it was admitted in writing that this was a financial heist and financial fraud, investors will follow if they see profit at the end of the process.”
Science Is Hijacked, Humanity in Dange
“Nature was hijacked. This whole story started in 1965 when we decided to hijack a natural model and decide to start manipulating it.
“Science was hijacked when the only questions that could be asked were questions authorized under the CDC the FDA the NIH and their equivalent organizations around the world. We didn’t have independent science.
“Unfortunately, it was no moral oversight in violation of all of the codes that we stand for, there was no independent financially disinterested independent review board ever empanelled around coronavirus, not once. Not since 1965.
“We do not have a single independent IRB ever empanelled around coronavirus. So morality was suspended for medical countermeasures, and ultimately humanity was lost, because we decided to allow it to happen.”
So Dr David Martin urges the world community to take urgent actions:
“Our job today is to say no more Gain-of-Function research! Period!
“No more weaponization of nature! Period!
“More importantly, no more corporate patronage of science for their own self-interest unless they assume 100 per cent product liability for every injury and every death that they maintain.”
COVID-19 Pandemic (3) – The World
COVID-19 Pandemic (4) – The War
Unit 731, Japan’s Bio Warfare Army (1)
Took a while but I actually tested positive for Covid two weeks ago.. Symptoms started while on vacation in Ireland. Was like the flu but I had a very deep cough. Still have a little cough but the Canadian wildfires are affecting our air quality and I think the is part of the reason. Either way I’m still alive and well.
Dear Paul, so happy to see you here and learn you are recovering from your ordeal.
With just a few exceptions, all the people whom I personally know contracted once or twice, some have left me forever, very sad. I suffered most not from covid but vaccine which nearly killed me.
Hope you and you entire family cope well. It’s a difficult time, but it won’t last long. Cheers!